Загрузка...
Все видеоНовые видеоПопулярные видео

Molecular Biology Practice 1. What is the sequence of the mRNA produced from this gene? GAGCCAUGCAU…

Molecular Biology Practice 1. What is the sequence of the mRNA produced from this gene? GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC 2. What is the DNA sequence that produced this? 3. What is the sequence of the protein produced from this mRNA? (pay attention to the highlighted codon)

Watch the full video at:
https://www.numerade.com/ask/question/molecular-biology-practice-1-what-is-the-sequence-of-the-mrna-produced-from-this-gene-gagccaugcauuaucuagauaguaggcucugagaauuuaucuc-2-what-is-the-dna-sequence-that-produced-this-3-what-is-the-49263/?utm_medium=social&utm_source=youtube&utm_campaign=low_count_category

Never get lost on homework again. Numerade is a STEM learning website and app with the world’s largest STEM video library.
Join today and access millions of expert-created videos, each one skillfully crafted to teach you how to solve tough problems step-by-step.

Join Numerade today at:
https://www.numerade.com/signup/?utm_medium=social&utm_source=youtube&utm_campaign=low_count_category
#TheCentralDogma:UnderstandingGeneExpression

Видео Molecular Biology Practice 1. What is the sequence of the mRNA produced from this gene? GAGCCAUGCAU… канала Kevin Brooker
The Central Dogma: Understanding Gene Expression
Комментарии отсутствуют
Информация о видео
24 июня 2025 г. 13:01:34
00:00:33
Kevin Brooker
Теги
Правообладателям
Жалоба на материал Недопустимый материал Нарушение авторских прав
Комментарии
Поделиться
Другие видео канала

Find local extrema and saddle points of the function f(x, y) = y^2 - 3y cos x , -1 less or equal (x…Find local extrema and saddle points of the function f(x, y) = y^2 - 3y cos x , -1 less or equal (x…

'choose your poison Define the appropriate field to implement simulations of people waiting in line…'choose your poison Define the appropriate field to implement simulations of people waiting in line…

"An experiment consists of drawing card trom standard 52-card deck Let E be the event that the card…"An experiment consists of drawing card trom standard 52-card deck Let E be the event that the card…

Prove that f is continuous at a if and only if lim_h →0f(a + h) = f(a)Prove that f is continuous at a if and only if lim_h →0f(a + h) = f(a)

Which of the sequences {a_n} in Exercises 27-90 converge, and which diverge? Find th…Which of the sequences {a_n} in Exercises 27-90 converge, and which diverge? Find th…

Find the indicated sum. For Exercises 81 and 82, use the summation properties from Section 10.1. …Find the indicated sum. For Exercises 81 and 82, use the summation properties from Section 10.1. …

Rotten Apple?" Please respond to the following: Watch the following 2013 Bloomberg's video: Based o…Rotten Apple?" Please respond to the following: Watch the following 2013 Bloomberg's video: Based o…

A pollen grain is a. a 3n structure. b. a diploid structure. c. first a diploid and then a haploid …A pollen grain is a. a 3n structure. b. a diploid structure. c. first a diploid and then a haploid …

Find the exact length of the polar curve. r = 2(1 + cosθ)Find the exact length of the polar curve. r = 2(1 + cosθ)

What functional groups are responsible for the absorptions above 1500 cm^-1 in the IR spectra for…What functional groups are responsible for the absorptions above 1500 cm^-1 in the IR spectra for…

A titration may be based on several different types of chemical reactions. Which of the following i…A titration may be based on several different types of chemical reactions. Which of the following i…

In the following exercises, find the prime factorization of each number using the factor tree metho…In the following exercises, find the prime factorization of each number using the factor tree metho…

Predict the major product for each of the following Wittig reactions: (FIGURE CANNOT COPY)Predict the major product for each of the following Wittig reactions: (FIGURE CANNOT COPY)

Solve the following systems by determinants: (a) {[ 2 x-5 y+2 z=2; x+2 y-4 z=… ]Solve the following systems by determinants: (a) {[ 2 x-5 y+2 z=2; x+2 y-4 z=… ]

Broth harvested from a fermenter is treated for recovery and purification of a pharmaceutical compo…Broth harvested from a fermenter is treated for recovery and purification of a pharmaceutical compo…

Japan generally runs a significant trade surplus. Do you think this is most related to high foreign…Japan generally runs a significant trade surplus. Do you think this is most related to high foreign…

The following problems consider the historic average cost per gigabyte of RAM on a computer. \begin…The following problems consider the historic average cost per gigabyte of RAM on a computer. \begin…

Young's double-slit experiment underlies the instrument landing system used to guide aircraft to sa…Young's double-slit experiment underlies the instrument landing system used to guide aircraft to sa…

'Units of X MU; Units of Y MU,''Units of X MU; Units of Y MU,'

The following graph represents the demand and supply for pinckneys (an imaginary product). The blac…The following graph represents the demand and supply for pinckneys (an imaginary product). The blac…

Find the area of the region between the curve y=2^1-x and the interval -1x ≤1 of the x -axis.Find the area of the region between the curve y=2^1-x and the interval -1x ≤1 of the x -axis.

TopArticle.Ru
Статистика портала
Яндекс.Метрика
© 2008-2025 «Информационно-развлекательный портал города Верхняя Салда»
| Карта портала | Реклама | Контакты | Сообщить об ошибке | Соглашения Пользовательское соглашение Соглашение о конфиденциальности Согласие на обработку персональных данных Информация для правообладателей Об использовании Cookies
salda.ws@mail.ru
Сейчас на сайте: 385 Статистика портала
Страницу в закладки Мои закладки
Все заметки Новая заметка Страницу в заметки